Programme Title International Foundation Programme Module Title Introduction To Financial & Management Accounting Module Code 07 39253 Assignment Title Case Study Analysis Level Level 3 Weighting 50% Total Module Credits 20 W/C Hand Out Date At least 6 weeks before the due date Due Date By 23:59 on 04/05/2025 ASSIGNMENT FORMAT FILE UPLOAD (DOCUMENT) Essay/Report Format Formal Report Assignment Word Count 1500 words Module Learning Outcomes covered in this assignment 1. Record, summarise, and classify financial information in accordance with the principles & concepts of financial accounting & management accounting purposes. 2. Present financial information using basic financial statements and formal reports. 3. Analyse & interpret financial information in case studies and form. opinions based on facts (i.e. to draw conclusions and make recommendations). 4. Support their opinions, conclusions and recommendations using results of financial computations, evidence in the case studies, accounting concepts, accounting principles, basic elements accounting regulations, basic ethical principles, and other relevant evidence. Submission Format e-Submission (via canvas) Individual Background This case study is about a ficticious small business called Brum Cycles Limited, an electric scooters manaufacturing business based in The West Midlands Region of the United Kingdom. The company is currently operating in a harsh economic enviroment whith high inflation, plus the exchange rate of the British pound against major cuurencies has been declining gradually for the past 24 months, and it expected to continue declining for the foreseable future. In addition to that Brum Cycles operates in a very competitive market in which technology is evolving at a very fast pace. This case study is based on events which ocurred during the company’s financail year which started on the 6th of November 20X2 and ended on the 5th of November 20X4. The business is owned and directed by Tina and Kaio, they are sibblings. Note: When attempting the questions for this case study assume that you are employed by an accounting firm which provides business advice to Tina and Kaio. Question 1 Task 1: Budgeting (45 marks) Tina has been using static budgets for planning, controlling and decision making for the past few years. She read a business news article which suggested that fixed budgets on their own are an inadequate for benchmarking and decision making. According to Tina the article suggested flexible and flexed budgets are more effective. You have asked by your manager to use the data below to demonstrate how flexed budgets can be used by Brum Scooters Limited. Last year the budgeted sales volume for scooters was 8,000 units but their actual sales volume was 11,500 units. a) Complete the budget in the table above to show the forecast profit and the profit per unit for a sales volumes of 8,000 units and 11500 units. State the profit per unit to 2 decimal places. (4 marks) b) Flex the budget to reflect the actual sales volume of 11,500 units and calculate the profit and the profit per unit. State the profit per unit to 2 decimal places. (7 marks) c) Calculate the variances for last year’s budget and state whether they are favourable or adverse (14 marks) d) Explain the causes of each of the variances for expenses and revenues in your flexed budget. (5 marks) e) As mentioned above Brum Cycles is currently using a static budgeting regime. Your line manager believes that the business would make more effective decisions if it switches to a more realistic system of measuring variances. Yor line manager also argues that static budgets on their own are an in adequate for decision making. Write a short report for the directors of Brum Cycles in which you support the argument made by your manager. You must compare the pros and cons of static, flexed and flexible budgets in your report. You must also quote some of the variance fugures in your flexed budget. (15 marks) Question 1 Task 2: Cost-Volume-Profit (CVP) Analysis (30 Marks) Tina and Kaio have limited knowledge of management accounting, they would like to know how their plans for next year may impact their profitability. Therefore, your manager has asked you to use the previous year’s master budget figures to complete a CVP analysis for next year. a) Calculate the breakeven point in units and revenue. (2 marks) b) Calculate the profit volume ratio (2 marks) c) Calculate the margin of safety in units for the sales volume of 11,500 units. (2 marks) d) Calculate the Margin of safety as a percentage for 11,500 units. State your answer to 2 decimal places. (2 marks) e) Calculate the number of units that would need to be sold to make a profit of £98,800. Round your answer appropriately. (2 marks) f) Your line manager had a meeting with Lulu and Tanaka and he recorded the notes below: “Tina and Kaio have limited knowledge of accounting and finance, but they are aware of the following: “Breakeven analysis or cost-volume-profit (CVP) analysis is the study of the interrelationships between costs, volume and profit at various levels of activity. However, they are not aware of the fact that it has several limitations and assumptions until today.” Your line manager would like you to write a report to Tina and Kaio in which you use your CVP analysis to address the following questions which they asked him: “ (1) How many scooters do we need to produce and sell in order to recover all of our costs for the next period?; (2) What is the amount of revenue we need to generate in order to recover all of our costs for the next period?; (3) How much will each scooter sold contribute towards covering our fixed costs and making a profit? (4) How much will each pound of sales revenue contributes towards our fixed costs and making a profit? ;(5) What is the extent to which our sales for the next period can decrease before a loss occurs?; (6) How units do we need to sell next year to make a profit of £98,800; and (7) Do the assumptions and limitations of your CVP analysis outweigh its benefits?.” (20 marks) Question 2 (40 Marks) Kaio specialises in managing the production function of the business, whilst Tina specialises in managing the administration plus the selling & distribution functions. Kaio has a degree in engineering. Tina has a diploma in bookkeeping and she is responsible for preparing and submitting statutory accounts. Tina has limited knowledge of management accounting, but she does some basic managements accounting tasks such as preparing static budgets and costing. As mentioned above the business is growing, and it is becoming more and more challenging for Tina to perform. all the administration tasks on her own. Therefore, Tina and Kaio have hired the firm of accountants you work for to support them with both financial accounting and management accounting tasks. You informed them that you will be stetting up a costing system which includes both marginal costing and absorption costing. Kaio does not understand why you need to carry out both marginal costing and absorptions costing. He believes that the company can save time, money and labour hours if they have one costing system. Your line manager would like you to demonstrate to Kaio why it may necessary for a business to adopt both costing systems. Therefore, he asks you to complete a report which includes statements of profit or loss under both costing systems for Kaio and Tina using the information below. Midland cycles makes one product, with the following costs: variable direct materials £9 per unit, variable direct labour £6 per unit, fixed overheads £90,000 per year. During the last year the company made 7,500 units and sold 10,000 units for £25 each. There were 2,500 finished units in inventory at the start of the year. The costs for the previous year were the same as above, and have been used to value the opening inventory. 7,500 units were made last year. a) Prepare the statements of profit or loss under absorption costing and marginal costing. (20 marks) a) Use this information to prepare statements of profit or loss would using absorption costing and marginal costing. (20 marks) b) It has already been stated above that Kaio does not understand why you have prepared two statements for the same product with different figures and different layouts. He thinks it is unnecessary to prepare two statements for the same product, and he also believes the company would save money and time if only one of the two statements were prepared. Your line manager would like you to write a report which will convince Tanaka that both statements are essential. Your line manager suggests that your report should compare and contrast the two profit and loss statements you prepared in terms of: (1) their objectives or purpose; (2) valuation of inventory; (3) the differences in cost of sales; (4) how costs are classified; (5) the differences or similarities in the profit or loss in the statements; (6) compliance or non-compliance with accounting standards; (7) Strengths; and (8) limitations. (20 Marks) Qurestion 3 (65 marks) Kaio and Tina are planning to invest in a new product. They require an annual rate of return of 10% from this projects and a payback period of 4 years. Tina has complied the data in the table below which she used to estimate the payback period for the project. Tina thinks they should go ahead with the project because according to her estimation, they can recover their capital within their target period of 4 years. Your manager advised Tina and Kaio that payback period on its own is an inadequate decision making tool, and he aggreed with them that your firm would appraise the project using advanced techniques. a) Your manager has delegated the task of appraising the project to you. Use the layout in the table below to show the workings for your calculations for payback period, net present value and discounted payback period. (30 marks) Net Cumulative Discount Discounted Cumulative Cashflow Cashflow Factor @ 15% Cashflows Discounted Cashflows Year 1 Year 2 Year 3 Year 4 Year 5 Payback Period = Years & Months Net Present Value = Discounted Payback Period = Years & Months b) What advise would you give to Tina based on the data in your analysis? (3 marks) c) Your manager estimates that the internal rate of return for the project is close to 20%. Your managers asks to calculate the internal rate of using the NPV you calculated at 15%, and the NPV at 20% which is approximately £0.22. Show your workings. (5 marks) d) What advise would you give to Tina and Kaio based on the internal rate of return you calculated. (2 marks) e) Your manager would like you to presenst your capital investment appraisal computation and written reports at the next meeting with Tina and Kaio. He asks you to write a report to Tina and Kaio in which you elaborate on the advice he gave about using payback period on its own for appraising longterm projects, especially in the economic environment mentioned in this case study. Your report must compare the strengths and limitations of paypack period with the strengths and limitations of the discounted cashflow techniques you used in your analysis. (25 marks) Important Information All reports must have citations and references. You must quote academic sources which include textbooks, journal articles and reliable websites. You must submit your work in microsoft word format only. Do no submit PDF documents. Presentation/structure, spelling, punctuation, grammar and referencing will be considered when assessing your work. Unless instructed otherwise by your tutor, please follow the below instructions: Word count 1,500 words File type Word processed Font 12 pitch font – Arial or Times New Roman Format Double spaced and justified Referencing Harvard system Notes Your assignment must include page numbers and word count. You will receive a 10% penalty for this assignment if you go over the word count by more than 10%. If your assignment is significantly under the word count, you may not have answered the question in full. This will be reflected in your overall mark and feedback given by your tutor. The word count does not include contents, end of text references or appendices.
COMP4126 Research Methods Coursework 3: (Abridged) Literature Review Note: This coursework is similar to the onefor the same module at UNUK. Number of Credits: 50% of module Recommended hours: 40-50 hours (for distinction level) Submission Deadline: 8 May by 16:00 Late submissions will incur a penalty of 5% per day. Submit on Moodle-a link to a submission form. will be provided a few days before the deadline. Questions: If you have any questions about this coursework, please ask them: 1) in class, 2) after class during the consultation hours of the convenor, or 3) in the Forum at Moodle for Coursework 3. Individual questions received via email will be redirected towards these other options due to the class size. Aim of the Coursework • Search, examine, summarize, compare, and categorize 10 academic papers in your area of interest. • Identify a dissertation topic and supervisor. Learning Objectives: • Critically appraise research papers/methods. • Discuss managerial, political, economic, and ethical challenges in research. • Apply research approaches to problems. • Write research proposals. • Evaluate and compare research strategies. Task Description 1. Choose a Topic: Align with your dissertation. Select 10 research papers (include DOIs). 2. Summarize Papers: Use the template from Coursework (CW) 1 (1 paragraph per paper). 3. Categorize Papers: Group by themes, methods, application domains, etc. Include a table/figure for categorization. 4. Supplementary Figures: o Histogram of publication years. o Representative image from each paper with captions. 5. SurVis Web Page: Create a GitHub-hosted SurVis page. Include a screenshot and URL. 6. References: Alphabetical list with DOIs. Finding Research Papers • Start with a recent survey paper if no supervisor. • Use resources like ConnectedPapers.com and highly cited works. Summarizing Research Papers For each paper: • Explain evaluation methods (qualitative/quantitative, user studies, mathematical proofs, etc.). • Highlight evidence used (e.g., datasets, performance metrics). Categorization Group papers by: • Themes (e.g., ethics, algorithms). • Methods (e.g., case studies, interviews). • Application domains (e.g., healthcare, finance). Include a brief rationale for categorization. Literature Review Template Title: [Your Topic] Literature Review Name, Student Number 1. Introduction and Motivation (Approximately 1-2 paragraphs) • Describe the topic’s importance. • Include a meta-data figure (e.g., publication year histogram). 1.1 Research Field Challenges (Approximately 1 paragraph) • List challenges (e.g., data privacy, algorithmic bias). • Support with citations (e.g., Edmunds et al., 2012). 1.2 Survey Scope (Approximately 1-2 paragraphs) • Define included/excluded topics. 1.3 Search Methodology (Approximately 1-2 paragraphs) • Name your supervisor. • Mention keywords/survey papers used. • Include a ConnectedPapers.com screenshot. 1.4 Classification of Literature (Approximately 1-2 paragraphs) • Describe categorization logic. • Add a SurVis screenshot + URL. 2. Paper Summaries • Organize by categories. The sub-sections correspond to your literature classification (i.e., categories). (e.g., "2.1 Machine Learning"). • Use 1 paragraph for each paper summary based on CW1. Whatever you do, do NOT include the paper title, authors, and words from the paper summary template, e.g., “Concept”, ”Implementation”, etc, in your descriptions. Paper summaries appear as standard natural language text in one paragraph.
FACULTY OF BUSINESS AND ECONOMICS MFIN7016 Real Options and Dynamic Corporate Finance Module 5 Final Examination Submit your answers to all three questions before 10:00 pm on April 23, 2025. 1. In December 2024, your company faces a decision to bid for a eight-year lease on a coal mine offered by the government. The lease gives the winner of the auction the right to actually develop the mine for four years. Once development takes place (if ever at all), the leaseholder can extract 25 million tons of coal per year for exactly four years with the fixed extraction cost of $4 per ton. Development of the mine costs $50 million. There are no reclamation costs at the end of the life of the mine. If development did not take place by December 2028 (four years down the road), then the lease would end at that time. At the time of the auction, the spot price of coal was $4.58. The risk-free rate of interest is 6% per year and the net convenience yield on coal is 3.5% per year, both of which are constant and compounded continuously. The standard deviation of log changes in coal prices is 15% per year. Development costs are depreciated on a straight-line basis over four years. There are no net working capital requirements. The marginal tax rate of your company is 40%. There is no inflation. (a) Suppose that your company commits to an immediate development of the mine. What is the maximum amount that your company should bid in the auction for the lease? (b) Build a four-step binomial tree with a time step set equal to one year. Calculate the value of the lease by the real options approach. (c) Now, your company knows that the government might terminate the lease (if development has not occurred) at the beginning of the fourth year with a 10% chance. However, if development has started at or before the end of the third year, there is no risk of a government termination of the lease. Redo part (b). Why is the value of the lease different from that in part (b)? 2. Consider a risk-neutral firm that has a project whose value evolves over time according to the following geometric Brownian motion: dV (t) = 0.02V (t)dt + 0.3V (t)dZ(t), where the growth rate is 2% per year, the volatility is 30% per year, and dZ(t) is the increment of a standard Wiener process. The value of the project at t = 0 is $10 million. The instantaneous risk-free rate of interest is 5% per year. As such, the convenience yield is 5% - 2% = 3% per year. The firm can undertake the project at any time t by paying $10 million at that time to receive V (t). (a) As an approximation, the firm employs a discrete-time analysis to deter- mine its optimal investment decision as well as the value of the investment option at t = 0. Specifically, the firm builds a four-step binomial tree to approximate the geometric Brownian motion of V (t), where each time step is of one year. In this framework, the firm assumes that the project only lasts for four years. What is the threshold value of the project (i.e., investment trigger) at which the firm undertakes the project? What is the value of the investment option at t = 0? (b) Now the firm uses a continuous-time analysis, taking into account that the investment option is perpetual. Let V* be the threshold value of the project (i.e., the investment trigger) and F(V (t)) be the value of the investment option at time t. If V (t) ≥ V* (i.e., the stopping region), the project is immediately undertaken. If V (t)
Assignment 2 CSSE3100/7100 Reasoning about Programs Due: 4pm on 6 May, 2025 The aim of this assignment is to consolidate your understanding of the course's material on arrays and program derivation. It is worth 20% of your final mark for the course. Submission instructions: Upload two Dafny files to Gradescope: the first (A2.dfy) with your solutions to Q1-Q2 (and Q4 for CSSE7100 students), and the second (A2-Q3.dfy) with your solution to Q3. The files should be formatted as per the formatting instructions below. IMPORTANT: If either of your files have syntax or other parsing errors, i.e., VS Code does not report "Verification Succeeded" or "Could not prove ..." then the autograder will not be able to run on that file and your mark will be capped at 3.5/18 marks for A2.dfy and 1/2 marks for A2-Q3.dfy. Code which does parse but reports "Could not prove ..." is accepted by the autograder and will receive part marks based on the marking criteria below. 1. A program is required to rearrange the elements of an integer array so that where possible a[i] == i. For example, the array [2, -3, 4, 1, 1, 7] could be rearranged to [-3, 1, 2, 1, 4, 7] in which a[1] == 1, a[2] == 2 and a[4] == 4, but a[0] == -3, for example, since there is no 0 in the array. Another possible rearrangement of [2, -3, 4, 1, 1, 7] would be [1, 1, 2, 7, 4, -3]. As long as the values at indices 1, 2 and 4 are as required, the placement of the other values in the original array (-3, 1 and 7) don't matter. (a) Specify a method Rearrange which performs such an arrangement of an input array a. Your precondition should only specify what is required, and no more (it should not be too strong). Your postcondition should allow the described behaviour only, not other behaviours (it should not be too weak). (3 marks) (b) To implement the method, you will write a program which iterates through the array indices using a variable n which is initially set to 0. During this iteration, if a[n] is an index of a and the value at that index is not a[n], then swap the value at a[n] with the value at that index. Then check a[n] again and do another swap if appropriate. For the example above, we would have the following (where ↑ denotes the index n). In all other cases, move to the next index. Continuing with the example above, we would have To enable re-evaluation of the value at the current index after a swap, you must use an inner loop. You must use while loops (not for loops) and must not use return, break or continue statements. Specify the outer and inner loops (with a guard and invariant) such that the outer loop guarantees your method's postcondition, and the inner loop guarantees the outer loop invariant. To do this use the loop design techniques from lectures, and state which technique you used in a comment at the end of, or below, each invariant. For any additional invariants required, state the need for the invariant in a comment at the end of, or below, the invariant. (6 marks) (c) Write code for your method which Dafny can verify to be partially correct. To stop Dafny from trying to prove total correctness, put decreases * below your postcondition and invariants. (1 mark) 2. The program of Q1 will be used to find the lowest number from 0 up to, but not including, a.Length that is not a value in a given array a. (a) Specify a method Find which given an integer array a, returns the required value in output variable r. If there is no value missing from the array, r should be a.Length. The method must maintain the integers in the array, but does not need to maintain their order. Your precondition should only specify what is required, and no more (it should not be too strong). Your postcondition should allow the described behaviour only, not other behaviours (it should not be too weak). Hint: For simpler predicates, use sequence notation in your specifications (5 marks) (b) To implement the method, you will call Rearrange from Q1 on the input array and then use the output variable r to iterate through the array to find the required value. You must use a while loop and must not use return, break or continue statements. Specify the loop (with a guard and invariant). To do this use the loop design techniques from lectures, and state which technique you used in a comment at the end of, or below, each invariant. For any additional invariants required, state the need for the invariant in a comment at the end of, or below, the invariant. (2 marks) (c) Write code for your method which Dafny can verify to be partially correct. Again put a decreases * below your postcondition and below the invariant. (1 mark) 3. After copying your solutions to Q1 and Q2 to a file A2-Q3.dfy, remove the decreases * annotations, to see ifDafny can prove that the methods are totally correct. For each loop which cannot be proved to terminate, provide a termination metric. This question is meant to be challenging. The inner loop of Rearrange will most likely require a non-trivial termination metric, and Dafny may have trouble using it to prove termination. To aid Dafny, try the following. - Declare a ghost variable before the inner loop which keeps track of a value used in your termination metric. - Add an invariant that captures what is true of your ghost variable on each loop iteration. - Add code to your loop body to modify your ghost variable so that the invariant is maintained. Hint: Think of writing your termination metric in terms of sets. See Week 8's lectures for how to specify a set using a set comprehension, and the following webpage for Dafny's set notation and operators: https://dafny.org/dafny/DafnyRef/DafnyRef#sec-sets. (2 marks) 4. (CSSE7100 only) Add a method FindAll to the file where you have completed Q1 and Q2. When given an integer array a, FindAll will return a Boolean array b of the same length as a. For each value ofi from 0 up to, but not including, a.Length, if i is in a then b[i] is true and if i is not in a then b[i] is false. The method must maintain the integers in the array, but does not need to maintain their order. Specify and implement FindAll so that it can be verified in Dafny. Your implementation should call Rearrange from Q1 on the input array and then use a local variable n to iterate through the array to create the required array b. Ensure you satisfy the requirement on pre-and postconditions, and on justification of invariants, that were given for Q1 and Q2 above. Hint: If a loop body changes part of the heap (such as an array), Dafny will assume that everything on the heap is in the loop frame. (4 marks) Formatting instructions The specification and code for Q1 and Q2 should be added to the template file A2.dfy. Do not change the provided method headers nor the order of the methods. Do not add additional methods nor use assumptions. You should not need to use lemmas, but may do so if you wish. All lemmas used must have a proof. To allow us to (partially) auto-grade your solution, ensure that your loop variable in Rearrange is n, and your loop variable in Find is r (the output variable). In both methods, you must use while loops (not for loops) and must not use return, break or continue statements. For Q3, copy your code to a second file A2-Q3.dfy and remove all occurrences of decreases *. Then modify as required. Do not change the provided method headers nor the order of the methods. Do not add additional methods nor use assumptions. You should not need to use lemmas, but may do so if you wish. All lemmas used must have a proof. (CSSE7100 students only) template file A2.dfy. Do not change the provided method header The specification and code for Q4 should be added to the s nor the order of the methods. Do not add additional methods nor use assumptions. You should not need to use lemmas, but may do so if you wish. All lemmas used must have a proof. To allow us to (partially) auto-grade your solution, ensure that your loop variable in FindAll is n. You must use while loops (not for loops) and must not use return, break or continue statements. Marking You are expected to be able to correct syntax, parsing and similar errors which prevent the verifier being run. Failure to do so will cap your overall mark as detailed above. For Q1 and Q2, you will be awarded full marks for code which verifies and has correct pre- and postconditions and correct invariants with comments about how they were derived or why they are otherwise needed. For Q3, you will be awarded full marks for code which verifies and has correct termination metrics where required by Dafny. You will lose marks as detailed below. Q1 You will lose 1 mark for each pre- or postcondition that you are missing (capped at 2 marks), and 0.5 marks for one or more unnecessary preconditions and 0.5 marks for one or more unnecessary postconditions. You will lose 1 mark for not having an inner and outer loop. You will lose 0.5 marks for each invariant that you are missing (capped at 2.5 marks) and each invariant that is not appropriately commented (capped at 2.5 marks). You will lose 1 mark if your code does not verify. Q2 You will lose 1 mark for each pre- or postcondition that you are missing (capped at 4 marks), and 0.5 marks for one or more unnecessary preconditions and 0.5 marks for one or more unnecessary postconditions. You will lose 0.5 marks for each invariant that you are missing (capped at 1 mark) and each invariant that that is not appropriately commented (capped at 1 mark). You will lose 1 mark if your code does not verify. Q3 You will lose 1 mark for an incorrect termination metric and 1 mark if your code does not verify. Q4 (CSSE7100 students only) You will lose 0.5 marks for each pre- or postcondition that you are missing (capped at 1 marks), and 0.5 marks for one or more unnecessary pre- or postconditions. You will lose 0.5 marks for each invariant that you are missing (capped at 1 marks) and each invariant that is not appropriately commented (capped at 1 marks). You will lose 0.5 mark if your code does not verify. Your final mark will be M + (m - 4) where M is the mark for Q1-Q3 (out of 20) and m is the mark for Q4 (out of 4). The mark you will see on Gradescope for Q4 will be (m - 4). Note that this will be 0 for m = 4 and negative for a mark less than 4. All questions For each question, additional marks (up to the total marks for the question) may be taken off for work regarded as having little or no academic merit.
ELEC9715 Electricity Industry Operation and Control Assignment 2 This assignment will be distributed to you in week 7. It is due at the end of week 9, Saturday midnight. Your submission should be a pdf document of your completed assignment submission uploaded into Moodle. The assignment must be submitted individually and must be your own work. The UNSW policy on student plagiarism can be found on the www.lc.unsw.edu.au website and you should note that we use automated software to check assignments. The assignment will be marked out of 20 (6 marks for each question and 2 marks for overall presentation of your report). Late submission without good reason, as explained in an email to the course lecturer prior to the due submission time, will see marks reduced as per the details in the Course Guide. Late submissions must be directly emailed to the lecturer as well as uploaded into Moodle. In keeping with the recommended hours per week of study for a six unit of credit course, (9 to 10 hours of self-directed work per week) we suggest you spend around 20 hours in total on the assignment. The assignments are excellent preparation for the final exam, hence worth doing well, and it is essential that you do it yourself. Question 1: Note that there is a spreadsheet in the assignment workbook to assist in answering this question. Calculate the optimal unit commitment program using forward dynamic programming for the power system described below over a day’s (24 hours) operation. The power system has PV, Wind, Coal, CCGT, and OCGT generation, with operating characteristics as shown in the table below. It also has 16GWh of battery utility energy storage (BESS) with a maximum discharge / charge of 2GW (ie. an 8 hour storage system). For simplicity, assume that there are no round trip losses in operating the storage (typically around 90% round trip efficiency for li-ion). Assume that all generators can operate at any level between 0MW and their installed capacity, except that there must always be at least 1GW of coal running (minimum operating levels for the 3GW of coal plant). Note that there is a $50/tCO2 carbon price on the electricity industry. This power system might have some similarities to a future NSW generation fleet. Generation technology Capacity GW Op. cost $/MWh Emissions tCO2/MWh PV 6 0 0 Wind 6 0 0 Coal 3 30 1 CCGT 1 110 0.4 OCGT 4 170 0.6 For convenience the day is divided into 6 four time blocks. Over the day demand varies from 4 to 12GW, while the wind and solar also vary between 1-3GW and 0-5GW respectively as shown in the table below. You’ll note the daily capacity factors of around 38% and 28% respectively for this wind and solar. You can assume that the day-ahead forecasts for these renewables are very accurate. The residual demand after subtracting renewables that must be met from the thermal generation (Coal, CCGT and OCGT) is also shown. Keep in mind that 1GW minimum coal generation requirement at all times. Hours 0-4 4-8 8-12 12-16 16-20 20-24 Demand 5 10 4 5 12 8 PV 0 0 4 5 1 0 Wind 3 2 1 2 3 3 Total PV + Wind 3 2 5 7 4 3 Residual demand 2 8 -1 -2 8 5 To solve optimal battery storage operation and mimimise industry operating costs over the day, first calculate the operating cost of the thermal generators for supplying residual demand over 4 hours in 1GW increments from 1GW (the coal power generation which cannot be turned down further) to 8GW (the maximum available thermal plant capacity). As an example I have calculated the $k cost of supplying 1GW of thermal plant (the coal unit operating at its minimum operating level) in the spreadsheet. Now you can solve optimal battery storage operation using dynamic programming. For convenience, you can assume that the BESS is at 25% state-of-charge (4GWh of electricity) just before the first four hour block (0-4 hours). Also, the battery can only operate at 0, 1GW or 2GW charging or discharging, and stays at the chosen rate for the entirety of any four hour period. Also the BESS, and must be returned to 25% state-of-charge at the end of the last time block (20-24 hours) - otherwise, the lowest cost option would always be to empty the storage at the end of the day. You may find the table in the assignment spreadsheet of assistance in solving the dynamic programming, including the way it lays out the state space. Note that not all states at all time periods may be feasible (due to 2GW maximum charge/discharge limits on the BESS or the minimum 1GW of coal) or acceptable (you can assume that total demand must always be met). Some wind and/or solar may need to be curtailed at times as well. What is the optimal charging / discharging trajectory for the battery storage over the day, and the lowest possible operating cost for the power system over the day? You’ll need to complete the table and then visually show the least cost BESS operating strategy over the 24 hours To assist, I have solved the State transition costs for the first time step (0-4 hours) and there is space for you to calculate the total cost of getting to each State from every other feasible or acceptable State, making it easy to then identify the least cost path to each State, and use these when calculating the least cost for the next time step. Note that when determining the cost of meeting residual demand you need to consider reduced thermal generation (hence lower system operating costs over the four hours) if you discharge the storage, and increased thermal generation (hence higher system operating costs) if charging over that time. Also, given the maximum charging rate of 2GW the storage state-of-charge can only change by a maximum 50% (8GWh) from one four hour time period to the next. Discuss your findings and their implications for energy storage in a power system with lots of PV, wind that mainly blows in the early morning and late evening, and demand that is relatively low overnight with a morning peak and then larger early evening peak. Do you think more BESS is required in this power system? Does the carbon price have a significant impact on BESS operation? Question 2 Note that the assignment workbook has 30 minute NSW NEM pricing and a particular PV plant’s generation for calendar year 2024. Your are a trader for a company that owns a 102MW utility PV plant in Western NSW that has previously sold a Power Purchase Agreement (PPA) for its entire output to a large NSW University. The agreed strike price for this PPA was $60/MWh and the 15 year contract runs from the start of 2024 through to 2039. This contract is effectively a variable volume CFD and works as follows. For every 30 minute period the spot price is subtracted from the PPA strike price and multiplied by the MWh generated during that time period to calculate the PPA value ($) over that time. Note that if the PV plant is generating at an average 100MW it generates 50MWh in 30 minutes). If the spot price is greater than PPA contract price in that 30 minutes then the generator pays the NSW University this money. If the spot price is below the PPA price then the University pays this money to the generator. The wind farm keeps all the spot market revenue. At the start of 2025 you are asked by your company to assess the value of this PV plant, and in particular the value of it’s PPA compared to what would have happened without the contract having been signed. They provide you with the 30 minute generation (MW) of the PV plant over the year, along with the NSW wholesale spot price (see the assignment workbook) . You can assume that this PV plant was not curtailed at any time; that is, the generation trace is how much the PV plant could potentially generate in each 30 minute period. Of course the operators might have chosen a different operating strategy and turned it down occasionally. Calculate the annual operating profit ($m/year) your PV plant would have made in 2024 considering the following scenarios: - Your PV plant had no PPA and received only spot market revenue over the year. The PV plant is operated at its maximum possible generation at each 30 minute period. - Your plant had no PPA and received only spot market revenue over the year. You, however, were in charge of its market participation and choose to to turn the PV plant down in any 30 minute period if you calculated that this would increase the plant’s overall operating profit. - The PV plant does have this PPA at $60/MWh and was operated at its maximum generation potential for each 30 minute period. - The PV plant does have this PPA but in the fine print of the contract with the University there is the following legal rider – “for the purpose of calculating the value of the CFD in each 30 minute period any negative market prices shall be defined as $0/MWh for the purpose of the calculation” The PV plant is still operated at its maximum generation potential over the year. - The PPA has this fine print, but you have now calculated an optimal dispatch strategy to maximise the operating profit of the PV plant. Think carefully what the optimal curtailment strategy is given both in terms of not having any PPA, or having this PPA with that fine print. It’s not necessarily the most obvious strategy :?). You can assume that your PV plant dispatch strategy doesn’t impact pricing which is a reasonable assumption. Be sure to present your results in a table showing separate CFD and spot market operating profits, as well as total operating profits for each of these 5 scenarios. At the same time you are doing these calculations, the NSW University’s energy team is celebrating its inclusion of that fine print in its PPA contract, but is also wondering how it could manage its exposure to NSW wholesale spot prices at times when its PPA isn’t covering its demand. In particular, the university often has its peak demand of 30MW at around 6pm when the PV plant they have contracted with isn’t providing much, or in winter any, generation. You are keen to help and suggest that they might want to contract separately with a gas peaking plant for a $300/MWh cap derivative. They ask you for advice on what would be a reasonable cost ($/year) to pay for a 30MW cap covering all 8760 hours of 2025. The market expectation is that NSW wholesale market pricing in 2025 will likely be pretty similar to 2024. What option fee would you suggest to the university as a possible starting point for this negotiation with a suitable gas peaking plant? Explain how you calculate this $/year fee. Discuss your findings and the importance of carefully designing renewable PPAs in a highly volatile spot market to manage risks for both PPA sellers and buyers, and for renewable energy projects to be responsive to changing market conditions in such cases, while PPA buyers need to consider their remaining spot exposure. Question 3: Note there are spreadsheets in the assignment workbook which will help you lay out your answers. A power system has a mix of old black coal plants, CCGT and OCGT gas fired generation, and wind and solar generation with overall capacity and operating costs as shown below (note the similarities with NSW). The coal plant is old and becoming unreliable with an estimated forced outage rate of 0.05 (5%) for 1500MW of the available plant (that is, you can expect that 1500MW of the coal plant is unavailable 5% of the time). The 2500MW of wind generation has the following overall probability distribution - 600MW for 70% of the time, 2000MW for 30% of the time). The 3000MW of solar generation can be roughly modelled as providing 1500MW for 50% of the time, and 0MW for the other 50% of time). Yes - these are major assumptions. All of this serves a load with the inverted load duration curve shown below. Note that the value of any Unserved Energy (USE) is estimated to be $20,000/MWh. Assume that the wind farm output, solar farm output and load, as well as the coal plant forced outages are all completely uncorrelated (meaning that the probability of being in any of the coal, wind, solar and demand states is independent of what the other states are so yes, rather simplified). Also assume all plants can be operated anywhere between 0MW and their rated capacity, with no start-up or shutdown costs (a very big assumption for the coal plant). The simulation period is one year ahead. Using the table provided in the assignment 2 workbook, enumerate all possible scenarios of coal generation availability, wind farm and PV output and load demand in terms of their probabilities (hence expected hours per year), ability to meet demand, and associated power system production costs ($/hr). Note that there are a total 16 possible states for this power system (2 wind states X 2 coal availability states X 2 demand states X 2 solar states). Use this table to calculate over a typical year: (a) Loss of load probability (total hours/year) (b) Expected unserved energy (USE) (% of load) (c) Expected production cost over the year ($000) noting again that any USE costs $20,000/MWh. (d) The average electricity price required to cover total production costs. Briefly discuss your findings and their potential implications for this power system as the black coal fleet continues to age. Do you think that this complete enumeration method is useful despite the assumptions? Let’s now consider a more realistic production cost model. The assignment workbook provides NSW 30 minute scheduled demand (MW) as well as solar (3.5GW installed), wind (2.6GW installed) and hydro (2.7GW installed) 30 minute traces for calendar year 2024. You can assume that the system has 7.2GW of black coal generation (operating cost $30/MWh) and 3GW of gas-fired generation (operating cost $150/MWh). You can assume that the wind, PV and hydro have $0/MWh operating costs.. First solve economic dispatch for this power system for each 30 minute period over the year. You can assume that the coal and gas plant have no minimum operating levels or ramp rates, and that all the gas and coal generation are always available if required. Likewise, there are no network interconnections, constraints or losses that you need to consider. For economic dispatch, you need to stack the available generation from lowest to highest operating cost up to the MW of demand for each 30 minute period. Note that Excel has a very useful function - MIN(x, y) that returns the lesser of two numbers, which just might be remaining demand vs available plant capacity for the next least cost generation technology. Any unmet demand in a 30 minute period is of course USE (unserved energy). Keep in mind also that 1000MW of any generator technology in 30 minutes represents 500MWh of generation - don’t accidentally estimate industry costs that are double the actual cost). Hence estimate the: (a) Loss of load probability (total hours/year) (b) Expected unserved energy (USE) (% of load) (c) Expected production cost over the year ($m) noting that any USE over the year costs $20000/MWh (d) Expected generation mix (ie. the % proportion of generation over the year from each technology). Now consider the case where 1.5GW of the coal-fired generation is increasingly unreliable with a forced outage rate of 0.05. That is, in any 30 minute period there is a 95% chance that 7.2GW of coal is available but a 5% chance of only 5.7GW being available. Estimate again the LOLP, USE, expected production cost and expected generation mix. You can use Excel’s Random number generator to determine if it is 7.2GW or 5.7GW of coal available in any and every 30 minute period. In many cases of course not all coal generation will be required so it may not change dispatch at all - at other times that missing generation may cause higher cost gas generation to run or even result in USE. Discuss your findings, including how the results compare with the simplified complete state enumeration model used above. Again, what are the potential implications for electricity industries with growing levels of renewables and increasingly unreliable old coal-fired generation.
Geographic Perspectives on Earth System Science Geography 210 Assignment #5: Water use in the Colorado River Due on Canvas by Friday April 18 at 11:59 PM Purpose Water is the most important resource for sustaining life on Earth and across the cosmos (as far as we know). Where we find water, we find life. Dependable availability of this precious resource then becomes paramount to sustaining and growing populations. As some areas face increasing water shortages, understanding the pressures on this resource becomes critical. In this assignment we will explore water levels along the Colorado River over the last ~100 years and explore what changes have occurred that are leading to water shortages today. This assignment uses stream gauge data, demographic data, and climate change projections to help you see a comprehensive picture of the changes and pressures facing the Colorado River. Objectives 1. To obtain and use geographic data to explore and understand physical patterns. 2. To grasp the difference in use vs availability of resources. 3. To become familiar with drivers of water consumption change. 4. To perform. basic analysis of scientific data. Your deliverables to be uploaded to Canvas 1. A document (Word or PDF) including thorough, original answers to all questions using complete sentences and correct grammar. Some questions require more than a one-sentence response, either a couple sentences or more. Some questions also require you to plot data from Excel. Include your plots in your writeup (copy and paste them). 2. Your Excel file from which you’ve performed all analyses and created your plots. Submissions not including the Excel file in which analysis was performed will be penalized 50%. Both are required by the due date for you to receive a grade. Also, if you are including any outside information, you are required to include a list of references at the end and in-text citations. Please reach out if you have questions about this. Background on the Colorado River and its water The Colorado River is a vital source of water for the American Southwest, in terms of drinking water, irrigation, and hydropower. Water from the Colorado River irrigates 15% of the US agricultural lands and those lands produce 90% of winter vegetables for the US market. The river is a vital resource that supports life, livelihoods, and industry across the Southwest. The Colorado River provides water for seven states, multiple Native American tribes, and two countries (Figure 1). The allocation of the river’s water to these various entities is governed by a set of legal and administrative frameworks, including compacts, treaties, and decrees collectively known as the “Law of the River.” Together, these establish how much water each entity is entitled to use from the river annually. In particular, the Colorado River Compact of 1922 divides the river’s flow between Upper Colorado River Basin states (Wyoming, Utah, Colorado, and New Mexico) and Lower Colorado River Basin states (Nevada, Arizona, and California), specifying allocation amounts in MAF (Million Acre-Feet). MAF is a unit of water volume commonly used in the US to measure large quantities of water, such as the annual flow of rivers or volumes of water within reservoirs. Simply, one acre-foot is one foot of water across one acre of area, equivalent to 325,851 gallons. Figure 1: Colorado River watershed and users (via https://www.coloradoriverdistrict.org/map-gallery/) Under the Colorado River Basin compact of 1922, access to 7.5 MAF was given to the upper basin states and 7.5 MAF to the lower basin states. In addition, 1 MAF was allocated for Mexico. It’s important to note that this allocation of 16 MAF per year total was based on river flow estimates at the time of writing (1922), which have since proven to be overly optimistic compared to the river’s actual average flow. Part 1: Colorado River allocations 1. The 1922 Colorado River Compact is the founding agreement that defines water allotments for each of 7 states. In the A5 Excel workbook, the ‘CRC Allocations’ tab contains the allocations for each state. Use that data to answer the following questions. The data values are given in terms of Acre Feet or the amount of water required to cover an acre of land with a foot of water. a. According to the data, what is the allocation for the upper basin, lower basin, and total of both? (3 points) b. Create a pie chart with an appropriate title, labels, and include the percent values for each state on the pie chart. (5 points) Part 2: Colorado River flows 2. The Colorado River flows through 7 states with its headwaters in the namesake Colorado. Look at the USGS stream gauge data for the Colorado River in Glenwood Springs, CO for the last year. https://waterdata.usgs.gov/monitoring- location/09085100/#period=P365D&dataTypeId=continuous-00060- 0&showMedian=false a. What is the current discharge rate (cubic ft/s)? (2 points) b. What is the maximum rate over the last month? (2 points) c. What is the maximum rate over the last year and when does it occur? (2 points) d. Thinking about the shape and timing of this peak flow, do you think this is driven by rain events or by mountain snow melt? Justify your answer. (3 points) 3. Look at the A5 Excel file and use the ‘Colorado River Flows’ tab to answer the following questions. The data values are given in terms of Acre Feet. a. When the Colorado River Compact was signed (1922), what was the average flow over the preceding decade (1911-1920)? (2 points) b. Given this amount, does an allocation of 16 MAF seem appropriate? (2 points) c. What was the average flow over the following decade after the signing of the Compact (1923-1932)? (2 points) d. Given this amount, does an allocation of 16 MAF seem appropriate? (2 points) e. What was the average flow over the following two decades after the signing of the Compact (1923-1942)? (2 points) f. Given this amount, does an allocation of 16 MAF seem appropriate? (2 points) g. What was the average flow since the signing of the Compact (1923-2024)? (2 points) h. Given this amount, does an allocation of 16 MAF seem appropriate? (2 points) i. Since 2000 (2000-2024), what was the average stream flow for the Colorado River? (2 points) j. Plot the total annual stream flow of the Colorado River from 1922 – 2024 as a line graph. Add an appropriate title and format the axes to make it legible. Select the data within the graph, right click on the data and select “add trendline”. Within the “Format Trendline” Options, click on Add Equation. Insert that graph into this document. (6 points) k. The trendline and equation provide a brief analytical description of the dataset. The slope (seen visually and described numerically as the first term in the equation) indicates the amount the dataset (in acre feet) is increasing or decreasing each year. Is this dataset increasing or decreasing over time? (2 points) l. Based on the data you just analyzed, what does this difference between allocations and actual flows mean for current and future water use? (at least 2 sentence answer in your own words) (3 points) Part 3: Population change data During this time of changing decreasing water availability, the area has seen increasing water demand, driven in large part by increasing population in the Southwest. No where is this more apparent than in Arizona. 4. In the data sheet, go to the ‘AZ Pop’ tab. a. What was the population of AZ in 1922? (2 points) b. What was the population of AZ in 2024? (2 points) c. By how much has the population of Arizona increased in the last 100 years (2024 vs 1925)? (3 points) d. Create a graph of Arizona population over the last 100 years. Create an appropriate title with useful labels for each axis and insert that graph here. (4 points) Part 4: Central Arizona Project (CAP) To service this growing population the Central Arizona Project was devised to direct water from the Colorado River to supply water to the growing population centers in Arizona. Read through the followings story map to understand more about the CAP https://storymaps.arcgis.com/stories/b7b28dd4c36a413e8d533ba540f998cb This description of the CAP highlights the achievements but fails to address the fundamental underlying challenge of water accessibility. 5. In the A5 Excel datasheet, use the ‘CAP’ tab to complete the following questions. a. Between 2000 and 2023 what was the average amount of water drawn through the CAP? (2 points) b. Comparing this amount with the total amount of Colorado River flows during this same time period, what proportion of the Colorado River is being diverted through the CAP? (3 points) c. Compared to Arizona’s original allocation, how much does the CAP increase Arizona’s water take from the Colorado River? (3 points) Part 5: Future conditions 6. Let’s use the IPCC’s Interactive Atlas for the following questions: IPCC Interactive Atlas Select variable “Total Precipitation” and select the medium term (2041-2060) time period and SSP 5-8.5. Click on the Western area of the US (Regions: Western North America). a. Using the Table Summary view, what is the Median (%) change in 2050 for this region? (3 points) b. Applying that % change to the average flow for the Colorado River from 2000- 2024, what is the expected water flow for the Colorado river in 2050? (3 points) c. Given what you know about the current water shortages in the West, what do you expect will happen to the Colorado River by mid-century? (4 points)
CS 211: Assignment 4 Building a Simple Processor in CircuitVerse Introduction This project guides you through the step-by-step construction of a simplified processor ar- chitecture inspired by the MIPS instruction set. Unlike the complex and variable-length instructions of the x86 architecture (which we study in class), this processor follows a clean, RISC-style (Reduced Instruction Set Computer) design. Key Features of This Design: • Fixed-length 16-bit instructions for predictable decoding. • Three instruction formats: R-type (register), I-type (immediate), and J-type (jump). • 4-bit general-purpose registers for simplicity. • Stepwise development over three phases: starting with basic arithmetic and grad- ually adding control flow and branching. • Modular structure: built using subcircuits for ALU, Control Unit, Register File, and Program Counter. This processor is intentionally simplified to reinforce fundamental processor concepts: in- struction decoding, ALU operation, register file management, branching, and memory ac- cess. It mirrors the design philosophy of MIPS — a classic teaching architecture — but uses a smaller data width (4-bit registers and immediates) and a compact instruction memory. Comparison with x86: • x86: CISC (Complex Instruction Set Computing) architecture, variable-length in- structions, many addressing modes. • This Project: RISC-style, fixed-length instructions, clean control flow, ideal for learn- ing core concepts. Please use the pdf about MIPS single cycle implementation for reference. Phase 1: Building an R-Type Instruction Processor Objective In this phase, we will design and implement a processor capable of executing basic R-type in- structions using a custom 16-bit instruction format. The processor will follow the Fetch–De- code–Execute model and be built in CircuitVerse. Instruction Format R-type instructions are 16 bits wide and operate entirely on register operands. The instruc- tion is broken down as follows: Bits Field Description Width 15–12 Opcode Operation type (ADD, SUB, etc.) 4 bits 11–8 Rd Destination register 4 bits 7–4 Rs1 Source register 1 4 bits 3–0 Rs2 Source register 2 4 bits Example: ADD R0, R1, R2 → Rd = R0, Rs1 = R1, Rs2 = R2 Supported Instructions (Phase 1) Opcode (bin) Mnemonic Operation 0000 ADD Rd ← Rs1 + Rs2 0001 SUB Rd ← Rs1 - Rs2 0010 AND Rd ← Rs1 AND Rs2 0011 OR Rd ← Rs1 OR Rs2 0100 SLT Rd ← (Rs1
FINAL PROJECT Final project topics: You must identify a topic that interests you and agreed by the instructor. See the list of possible topics for inspirations. For topics, the only requirement is that the topic must be civil engineering, environmental engineering, or engineering mechanics related. You are welcome to explore applications of machine learning in the wider realm of these fields (e.g., structural, geotechnical, environmental, traffic, urban). The evaluation of the final project will not be affected by the topic selected. List of possible topics (note that for all these topics, I can give you some general ideas of what specific tasks are out there and can be solved by machine learning techniques, but you are still responsible to find the data sourcefor specific tasks on your own): • Construction worker safety • Structural health monitoring • High performance building monitoring and control • Building cluster energy consumption and demand response • Construction robotics (e.g., navigation, object detection, assembly, human-robot collaboration) Final project team formation: you are expected to form. teams of two for the final project. Single person team is also allowed. Final project consultation: you are welcome to book a 30-min time slot with me (feel free to email me) and discuss any project ideas. Final project check-in: To facilitate the completion of the final project, we will have a final project check-in towards the beginning of the second half of the semester. For the check-in, you are expected to submit a maximum 2-page report outlining: (1) the main objective of the final project (2 points), and (2) existing/possible data sources (note that if there is no existing data source, a mechanism for collecting data needed for the project is required) (3 points). The final deliverable of the final project will be: (1) a report of the findings of the final project, and (2) a 10-minute presentation of the final result/product of the final project. You are also encouraged, but not required, to publish your work on open online repositories (e.g., GitHub). Final Report Guidelines: The final report should be maximum 10 pages in length, single space, 12 pt. Times New Roman, default margin. Include the following sections: Introduction (1-2 pages, 2 points): First introduce the significance of the problem. For example, if you are predicting energy consumption of buildings, you can mention facts such as buildings account for 45% of the energy consumed in the U.S. every year. Next, formulate the problem. How do you formulate your problem into a machine learning problem? What is the input, output? Where did you get the data? Background (1-2 pages, 2 points): what is the state-of-the-art model for the problem you are trying to solve? For example, if you are solving a hardhat detection problem, what is the best performing model for the problem hardhat detection? Why did you choose the model you are using? Cite the papers/sources you are referencing and give a succinct summary of their performance metrics and results. Methodology (2-3 pages, 8 points): lay out the model you used, the hyperparameter of the model, and the overall structure of model (e.g., if you are using CNN, what is the CNN structure, how many parameters, what are the layers, etc.). A figure depicting the overall work flow of the methodology is helpful. What did you do in each of the steps for this project (e.g., data collection, data cleaning, model architecture used, validation methods used, etc.) Metrics (1 page, 2 points): give definitions/equations of the metric you used. Results (3-4 pages, 4 points): show the results for your models, using the metrics you defined in the last section. Limitations (1 page, 2 points): what are the limitations for this project? How would you improve the project if you have (e.g., high performance computers, larger datasets, better ML models, more time, etc.)? Reference (does not count towards the total number of pages): give a list of references. 10-Minute Final Presentation Guidelines: This should be a presentation that captures the main idea and results of the project. It should show the most important and coolest parts of the project, with narration to explain how it works. Think of it as a 10-minute thesis presentation. The following criteria will be used for grading: • Did every member on the team present (0.5 point)? • Did the presenter properly motivate the audience regarding the problem being solved (1 point)? • How is this problem currently being addressed in the industry, in academia (1.5 points)? • Was the problem formulation clearly stated (1 point)? • Was the methodology clearly explained (2.5 points)? (What model, why this model? What architecture, why this architecture? What other models did you use as comparisons?) • Were the results clearly explained with proper figures, tables (2 points)? • Did the presenters provide a concise take home message for this project (0.5 point)? • Did the presenter properly acknowledge the limitations of this project and identified future directions (1 point)?
COMP2026 - Visual Analytics Autumn 2025: Assignment 1 Relational Data Visualisation (Assignment deadline: Sunday 20/04/2025, 11:59pm on vUWS) Assignment Details For this assignment, you are required to identify and develop one (or more) visualisation(s) for relational data sets (such as graphs, networks, and trees as presented in lecture notes in week 3 and week 4) using existing tools, software or your own development using available libraries. You might use the sample datasets at the tutorials as well as the provided visualisation techniques. Alternatively, you are encouraged to search and use other visualisation tools and/or datasets in the literature. Based on the visualisation(s), you can explore to find insight, patterns, ir(regularity) and interesting properties from the visualisation. You are also required to write a report (approximately 1000 words and a maximum of 1500 words) on the following aspects: • Brief technical details of the used visualisation method(s), • Discussion on the advantages and disadvantages ofthe visualisation method(s) in comparison with other methods in the literature. Can the visualisation method(s) be used effectively for large relational data sets, and why? • The visualisations that you develop. • Discussion on the analysis results and findings on the datasets, • Discussion on other aspects, literature review of related work and your critical thinking on the visualisation(s). Note: images (as figures) are essential and should be included in the report to illustrate the visualisations, results and findings. A report with more than 1500 words is not acceptable. Marking criteria for the assignment include • Development of visualisations for relational data (60%). You might use existing tools (e.g. tree visualisations, Gephi, Cytoscape, etc.), existing software libraries (e.g. D3.js) or write your own program in R, Python, Java or any other programming languages. The marking will be based on how well the visualisation methods present the relational data. Interaction should also be included in the visualisation. • A report on the technical description of the visualisation, analysis results and other aspects (40%) • Use of generative artificial intelligence (GenAI) is not permitted in this assessment task without appropriate acknowledgement. See advice on acknowledging the use of generative AI on the Library web page. Working with another person or technology in order to gain an unfair advantage in assessment or improperly obtaining answers from a third party, including generative AI, to questions in an examination or other form of assessment may lead to sanctions under the Student Misconduct Rule. Use of generative AI tools may be detected. More information is available on the Library web page. • Using GenAI to generate the content is not allowed, and using GenAI for paraphrasing and grammar check might be acceptable but it must be lower than 30%. (s).Discussiononotheraspectsliteraturereviewofrelatedworkand yourcriticalthinkingonthevisualisation erature.5%Present and discuss the developed vis esults andfindingson thedatasets10%
A. I. in Marketing writing assignment Select a news article, either in print or online, that addresses an issue or event pertaining to Artificial Intelligence (A. I.) in marketing. Then write a three to four page paper reviewing the following: 1. Important points of the article, 2. Why it interests you, and 3. How the article can impact someone’s career in marketing. Make sure to cite your sources accurately, and check for typos or writing errors. Upload to Canvas. Requirements: · Each paper should be a 12-font double-spaced Word file, and 3 - 4 pages in length (exclusive of title page and references). · Please use page numbers on your papers starting with the first page, not the title page. · Papers are graded based on content, organization, following APA or MLA style, and typos (in that order). ·Make sure to cite authors when you use their ideas or findings, even if it is not a direct quote. (Example: Research indicates that individuals who have mentors write better term papers than those who do not (Smith, 2023). · Make sure to include a title page, and a reference section at the end of your paper. · Please use these headings to organize your paper: Introduction, Why it interests me, Impact on marketing career, Conclusion, and References. Make sure to underline these in your paper.
Laboratory Assignment #2: The Industrial Revolution & Winner Take All Markets (4/21/2025) Generate a predictive model of either (A) civil war onset OR (B) urban civic revolutionary contention, then evaluate the model fit over time for a single case. For (A), begin by replicating the regression form. of Fearon and Laitin (2003). For (B), begin by replicating the regression form. of Beissinger 2022), Chapter 3 (Table 3.1). (Data here and here.) Feel free to work in a group, but each individual is ultimately responsible for turning in their own lab assignment. You can discuss the possibility of multiple model specifications with Jesus, who will hold office hours this week or meet virtually with you (or in small groups). DELIVERABLE: A .zip file to Jesus ([email protected]) containing (1) A document entitled “Explainer”: In 2-4 pages, briefly describing your modeling choices and describing the meaning of the coefficients that are statistically significant. Be sure to address the following questions in this short write-up: What are the important and robust predictors of the outcome you are modeling? (2) A document entitled “{Countryname}_{DV}” (for example: “Nigeria_CivilWar” or “Haiti_UrbRev) your model to plot the predicted probability of either civil war onset or social revolutionary onset for your country from Lab #1 over time (examples on back of this paper). Then write up a short essay that evaluates model fit against a sketch of the political history of this country. By “sketch”, what is expected is really just 1-2 pages…but note that Note that a single-country study like this can easily evolve into your midterm or final paper. What you turn in for this lab assignment should be short, but crisp, polished and professional looking, however, (not a “first draft” or outline). (3) Your R code to produce all tables/ figures in document 1 and 2, error and bug free Grading/Scoring: For the 4% of your grade, assignments will be rank-ordered by quality. We anticipate workable code will proliferate so there will be ample opportunity for free-riding on the backs of your more R-savvy classmates. In addition, there are two points-based incentives: “WINNER TAKE ALL” MARKETS: CAPITALISM/GLORY: The first two individual innovators to successfully complete the code portion for (A) or (B) and turn in an acceptable deliverable package will receive 6,000 points and 5999 points. The next two second-place individual innovators successfully completing the code portion of the other (B or A) will receive 4000 points and 3700 points. Third-place individual innovators receive 1000 each. An individual can “double dip” and receive as many as 11,999 points if they are the first to complete the code portions for both A and B. If a glory-seeker pursues this option, note that there is no need to do part (2) twice –code and a single “Explainer” document suffices for the second tranche points. PORK GOODS AS AN INCENTIVE FOR COSTLY COORDINATION: Each member of the first five-person “team” to complete the code portion of both (A) and (B) of the assignment will receive 2000 points each. An individual innovator can be a part of a coalition if they wish (double- or triple-dipping). If you wish to pursue this option, submit up to five .zip files together as a single .zip file to Jesus along with a clear/unified statement of who deserves individual merit credit. Fearon and Laitin (2003) on Nigeria: Beissinger (2022) on Ukraine
STATS 513 Winter, 2024 Exam #2 (Practice Exam for W25) In this exam, we use parts of a dataset to study the new FAIR policies/renewals per 100 housing units collected from different regions. The variables are: • fair: new FAIR policies/renewals per 100 housing units • race: racial composition in percentage of minority • fire: fires per 100 housing units • theft: thefts per 1000 population • age: percentage of housing units with age 25 years or older • income: median family income in thousands of dollars • region: different regions under study 1. A Q-Q plot (normal quantile plot) of ‘fire’ is shown in Figure 1. Please describe the distribution of the variable ’fire’ based on the plot: is it close to normal, long-tailed, short-tailed, skewed to the right, skewed to the left? 2. suppose we like to use the Jackknife residuals to identify which data point could be an outlier. The R-codes below can be used to find out the potential outliers. What are the values of df.ti and nnM? If you do not know the sample size, you can pretend the sample size is 160. ti=rstudent(m1) pp = 2*(1-pt(ti,df=df.ti)) alpha .v F) 1 140 5.4446 2 142 5 .4509 -2 -0 .0062269 0 .0801 0 .9231 5. For the ANOVA test above, one argues that we can conduct an equivalent t-test. Is this argument correct? If it is, please describe the exact t-test procedure for a 0 .05 level test to get full credits. If this argument is incorrect, please provide explanations. 6. Suppose we need to reduce the size of model ’m2.newR’. Based on the R-output, will the “testing- based” procedure and the “criteria-based” procedure, AIC, reach the same decision? Please report the decision one would make using each procedure, respectively, and explain how you reach each decision. 7. We let μA , μB , μC denote the means of Y = √fair for the three regions. Please provide a 95% confidence interval for μA and μA - μB , respectively. Note: you can use the notation tdf,γ without knowing its value, where P (X ≥ tdf,γ) = γ , but please do report the “df” and “γ” values you would use for the t df,γ when constructing the confidence intervals. 8. Would we reach a different conclusion here when we conduct all pairwise comparisons among μA , μB , and μC , controlling the family-wise error rate vs. controlling the individual error rate? Please briefly justify your answer. 9. Comparing m3 and m4, could we claim that m4 is a superior model than m4 by comparing their R2 ? Please justify your answer. 10. Based on the R-outputs, please comment on if there is a need to consider the subset removing the point with the largest Cook's distance. 11. Please comment on the output for ’anova(m2.newRa, m2.newR)’ and state what conclusion you make (or would not make) based on the F-test. > anova(m2.newRa, m2.newR) Analysis of Variance Table Model 1: fair^0 .5 ~ theft + poly(age, 2) + newR * fire Model 2: fair^0 .5 ~ race + theft + age + log(income) + newR * fire Res.Df RSS Df Sum of Sq F Pr(>F) 1 143 5.9648 2 142 5 .4509 1 0 .5139 13.388 0 .0003562 *** 12. Considering mod.glm, please provide the model that corresponds to mod.glm.
COMPX341-25A Assignment Two: Test Plan Specification Due date: 5 pm Friday 25th April, 2025 Submission: LaTeX PDF via Moodle and Testing Suite via UoW GitLab Weight in overall grade: 20% Abstract You work as a Software Engineer for SoTech, a software engineering company. A new and emerging Smart Home development company, called Encost, has approached your company with a proposed project called The Encost Smart Graph Project (ESGP). ESGP is a software system that enables the visualisation of Encost’s devices using a graph data structure. Introduction You still work as a Software Engineer for SoTech, a software engineering com- pany. While you were busy completing your software design, a different team was working on an alternative design, which the client has accepted. Your company (SoTech) and the client (Encost) have agreed on the Software Re- quirements Specifications (SRS) document and a Software Design Specifications (SDS) document. Your task now is to continue with the Functional Software Testing. Your task is to study the SRS and SDS documents that have already been accepted by the client and propose a Functional Software Test Plan. You will then use this plan to create a testing suite for test-driven development. Five SDS documents will be uploaded to Moodle. You have been given one of the SDS documents as the ‘client accepted version’. Please note, you cannot select a different SDS document. Overall, in the assignment, you are required to do the following. 1 Complete a Functional Software Test Plan A LaTeX template has been provided. Your task is to use the template to compile an engineering report for the project’s Functional Software Test Plan. Ensure you describe how each of the requirements in the SRS and SDS document will be tested. It is expected that you recommend automated testing to some extent, in these cases also recommend software tools that can perform such tests. Your functional software test plan must meet the following requirements: • Black-box testing: - Write tests to cover all High Priority functional requirements in the SRS, based on the design laid out in the SDS. • White-box testing: - Provide pseudocode for one of the Summary Statistic requirements. E.g. The system should use the information stored in the graph data structure to calculate the number of devices that exist in each device category. - Branch coverage testing: Develop tests that achieve 100% branch coverage for this pseudocode • Mutation testing: - Generate four mutants based on your whitebox testing pseudocode - Select two test sets (i.e., two sets of input-output pairs) and calculate the mutation score For each test, specify: • Level of test: e.g., unit vs. integration. And if integration, with what components • Test technique: e.g., equivalence classes, boundary values, coverage, mu- tation testing, decision tables, etc. • Test inputs: what inputs will be tested • You can use a test for more than one requirement. If shared tests are used to test different requirements, provide a table that maps test cases to requirements and or, if applicable, levels or components. 2 Complete a Suite of Functional Unit Tests Use your Functional Software Test Plan (specifically your black box testing) to write a suite of functional unit tests. All tests should be developed using JUnit. Your test suite must be submitted via GitLab (https://courses-git . cms.waikato.ac.nz). Notes 1. You are required to submit your test suite using UoW GitLab (https: //courses-git.cms.waikato.ac.nz). Please ensure that you commit to GitLab (providing good commit messages) throughout, not just at the end. 2. You are NOT required to implement your application. A Software Engi- neer will be tasked with implementing the software in such a way that it passes all of your unit tests. 3. You need to put enough information into your test plan and testing suite for someone else to develop an implementation from. Put yourself in their position (which you will be in yourself soon enough) and write with those people in mind. 4. Make sure you use a good, clear and consistent naming convention through- out. The names you chose in this document will be those used by the implementers in their work.
Coursework for CAN202 2024/25 S1 Summary of the coursework: i. The coursework contributes to 20% of the final mark of CAN202. ii. The maximum possible mark for this coursework is 100. iii. There are three questions, where each question contains a number of sub-questions. iv. Assessed learning outcome: B. v. Release date of the coursework: 7th April 2025. vi. Submission deadline: 23:59, 28th April 2025. vii. The usual late-submission policy may apply (i.e., 5 marks deduction per working day). viii. No generative AI may be used when completing the coursework. ix. Please submit ONE PDF file that contains your report and FOUR .m files. See below for more information. Please also read the following instructions for detailed guidance and requirements: i. The coursework requires you to perform programming in MATLAB. ii. Some MATLAB functions require additional toolboxes. You may need to install the following MATLAB Toolbox: Signal Processing Toolbox. iii. In the .m files, you must arrange the codes according to the sequence of the sub-questions. Add comments such that one can clearly identify the code designed for any sub-question; see appendix for an example. iv. You must ensure that the .m files can be executed without any error message. If an error occurs during execution, then the corresponding sub-question and all following programming sub-questions cannot earn more than 50% of their allocated marks (unless otherwise specified). v. Unless otherwise specified, programming sub-questions without any executable code cannot earn more than 50% of their allocated marks. vi. Any question that is not about programming can be answered by writing. Such writings should be clearly scanned and attached to the single PDF file that you are asked to submit. vii. When asked to provide plots (both in MATLAB-programming questions and analytical questions), please ensure that all axes are well defined and all labels and curves on the plots are readable to an old person. viii. Clearly label questions’ indices. Label page numbers and the total page number in the PDF. ix. Control the length of your answers as much as possible. 1. Double-sideband Suppressed-Carrier Amplitude Modulation (DSB-SC AM): In this question, you will use MATLAB and realize the modulation and demodulation of DSB- SC AM. The modulating signal for this question can be found by running the command “load handel” in MATLAB. After running the command, you will see two variables “Fs” and “y” in the workspace. The variable “y” is the digital data of a piece of song “hallelujah, hallelujah, …”, and the variable “Fs” gives the sampling frequency in Hz that is used to generate the data in “y” . You can listen to the song by running the following command in MATLAB (make sure you adjust the volume of your loudspeaker to a safe and audible level): “player = audioplayer(y, Fs); play(player);” The value of “Fs” is 8192. This sampling frequency should practically satisfy the Nyquist sampling theorem, i.e., one may consider that the samples in “y” are taken by a sampling frequency that is at least twice as much as the “effective” bandwidth of the soundtrack. The carrier frequency that you must use for the DSB-SC AM signal is x × 105 Hz, where x is the last non-zero digit of your student ID. For example, if your student ID is 1234560, then you should use 6 × 105 Hz as the carrier frequency. The demodulation is done using coherent detection, i.e., the correct carrier signal is multiplied to the modulated signal, followed by a suitable lowpass filter. After the demodulation process, you should get the same piece of song as the modulating signal from “handel”. We will implement the above in MATLAB. When doing so, we are in fact simulating a digital DSB-SC AM system. The carrier frequency is significantly larger than the bandwidth of the modulating signal, and the highest frequency component of the modulated signal will be much larger than the bandwidth of the modulating signal. Sampling the modulated signal with insufficient sampling frequency would cause frequency aliasing (as suggested by the Nyquist sampling theorem). As a result, we must sample the modulated signal with a much higher frequency than “Fs” from “handel” . Based on the above information, create a .m script named as “Q1_partA_abcdefg.m” for the sub-questions from a to i below, where abcdefg is your student ID: a. In MATLAB, load handel and play the soundtrack. Report what you hear. (1 mark) b. What is the maximum bandwidth of the soundtrack in “handel” such that the Nyquist sampling theorem is still satisfied? (1 mark) c. Plot a block diagram that shows how a DSB-SC AM signal is generated and how coherent detection is performed. Note that the bandwidth in Q1-a should be used to guide your design. (3 marks) d. Use the MATLAB function “fft” to plot the magnitude spectrum of the signal “y” from “handel” . You must supply both the code and the resulting plot in the report. Also, your plot must satisfy the following: (1) Clearly label the frequency axis in Hz. (2) Plot the spectrum such that the 0 Hz is at the middle of the frequency plot. In other words, show both the “negative” and positive frequencies in the plot. Consider the use of the MATLAB function “fftshift” . (3) Justify why the range of the frequency axis in your plot is correct (in relation to the sampling frequency that you use to perform. the discrete Fourier transform). (4 marks) e. It is sufficient to use the following sampling frequency to sample the DSB-SC modulated signal without frequency aliasing, i.e., “Fs_new = ceil( (Fs/2+fc) / Fs * 2 ) * Fs;” where fc is the carrier frequency you should use. Provide sufficient reasonings in the report on why Fs_new is sufficient to avoid frequency aliasing. (2 marks) f. Insert more samples to “y” from “handel” such that the sampling frequency is changed from “Fs” to “Fs_new” . You may use the MATLAB function “resample” . (2 marks) g. Plot the frequency spectrum of the signal in Q1-f using the MATLAB function “fft”, where the requirements listed in Q1-d must be satisfied. Compare the spectrum plot in this question to the spectrum in Q1-d and comment on your observation. (4 marks) h. Perform DSC-SC AM using the signal generated in Q1-f and a cosine carrier signal of the correct frequency (see rubric in the previous page). (2 marks) i. Plot the frequency spectrum of the signal generated in Q1-h. Your answer to this question must satisfy the requirements as specified in Q1-d. (2 marks) j. Multiply the signal in Q1-h by the same carrier signal used for DSB-SC AM and plot the frequency spectrum of the resultant signal. Your answer to this question must satisfy the requirements as specified in Q1-d. You may need to revise the sampling frequency. (4 marks) k. Apply lowpass filtering to the signal generated in Q1-j such that the frequency spectrum of the filtered signal resembles the spectrum of “y” . You may consider the use of the MATLAB function “lowpass” . (2 marks) l. Down-convert the sampling frequency of the signal generated in Q1-k to 8192 Hz. Then, play the down-converted signal in MATLAB. Discuss whether you have heard the same soundtrack as the one originated from “handel”. Note that your code must run and play in order to get marks for this sub-question. (3 marks) It is possible to use a non-sinusoidal periodic signal as a carrier signal. In this case, the to-be- modulated periodic signal is a periodic sawtooth wave that can be decomposed into an infinite number of sine waves (by means of the Fourier series). The sawtooth waveform S(t) is illustrated in Figure 1, where the Fourier series representation is given as After applying a suitable bandpass filter to S(t), one may obtain a desired carrier signal. Figure 1 A periodic sawtooth wave Use another .m script named as “Q1_partB_abcdefg.m” to answer the sub-questions from m to p below, where abcdefg is your student ID. m. In MATLAB, generate a periodic sawtooth wave using the MATLAB function “sawtooth” using a sufficiently high sampling frequency. Then, apply a suitable filter such that a sinusoidal wave of the desired carrier frequency (see rubric) appears at the output of the filter. Plot the output signal of the filter and verify that the output signal is indeed a desired carrier signal. You may use MATLAB functions “lowpass” or “bandpass” for designing the filter. (4 marks) n. Use the signal generated in Q1-m as the carrier and generate the DSB-SC AM signal, where the signal generated in Q1-f should be used as the modulating signal. (2 marks) o. In MATLAB, mix the signal in Q1-n with a suitable sinusoidal wave and apply a suitable lowpass filter to obtain a baseband signal. Plot the frequency spectrum of the filtered signal, where the spectrum plot must satisfy the requirements in Q1-d. (4 marks) p. Down-sample the signal generated in Q1-o and play the signal. Comment on whether you hear the same piece of song as that in Q1-a. Your code must be able to play the down-sampled version of the signal from Q1-o. (3 marks) (Question 1 carries 43 marks) 2. Superheterodyne Receiver: In this question, you will implement a superheterodyne receiver in MATLAB to demodulate one piece of music from the signal that is stored in the file “soundtrack.mat” . The file “soundtrack.mat” should be downloaded from LMO. Specifically, there are 10 pieces of music that are modulated by DSB-SC AM. Each piece of music lasts for 23 seconds, where the music signal has a bandwidth of 5000 Hz and a sampling frequency of Fs=10000 Hz. According to the last digit of your student ID, you should demodulate the bandpass music signal that has a carrier frequency as specified in the table below: Carrier Frequency Last Digit of Student ID 5 Hz 0 5 Hz 1 5 Hz 2 5 Hz 3 5 Hz 4 5 Hz 5 5 Hz 6 5 Hz 7 5 Hz 8 5 Hz 9 The signal “soundtrack” in “soundtrack.mat” are constructed by adding all 10 pieces of the DSB-SC AM signals, where the sampling frequency of “soundtrack” is 1140000 Hz and is stored as “Fs_new”. The baseband version of the 10 pieces of the music can be found in “music.zip” . You should download this file from LMO. Your task is to answer the sub-questions below which will enable you to demodulate the signal located at the carrier frequency as suggested by the table above. You must construct a superheterodyne receiver in MATLAB to perform the demodulation, where you must use the intermediate frequency of fi = 5 × 104 Hz. Create a .m script named as “Q2_abcdefg.m” for answering the following sub-questions, where abcdefg is your student ID: a. Plot the frequency spectrum of the signal in “soundtrack”, where you must fulfill the requirements in Q1-d. (4 marks) b. Observe the frequency spectrum in Q2-a and identify the 10 modulated signals by specifying the carrier frequencies and the bandwidths. (2 marks) c. What is the minimum required bandwidth of a communication channel such that the signal in “soundtrack” can be transmitted? Support your answer with evidence. (2 marks) d. For demodulation, using a superheterodyne receiver, you should first convert the target DSB-SC AM signal from the carrier frequency in the above table to fi, then use coherent detector to obtain the baseband music signal. Draw a block diagram that contains three filters and two mixers to achieve the demodulation, where you must specify the functionality of each component in the block diagram. (5 marks) e. Write a piece of MATLAB code that realizes the demodulation process in Q2-d. Specifically, you must fulfill the following requirements: (1) Provide a frequency spectrum plot at the output of each mixer and also each filter (5 spectra in total). The spectra figures must satisfy the requirements in Q1-d. (2) Make sure that the sampling frequency of the signal at the coherent detector output is 10000 Hz. (3) Play the signal at the output of the coherent detector and state if you hear a piece of guzheng music. (14 marks) f. Compare the sound you get from Q2-e to the 10 pieces of music in “music.zip” . You should un-zip “music.zip” and listen to each of the 10 music. Do you find one piece that is the same as the one from Q2-e? Are there any differences? State your answer and provide justifications. (2 marks) g. State both the last digit of your student ID and the name of the music file that best matches the sound you obtain from Q2-e. Note that there is a single correct answer. (1 mark) (Question 2 carries 30 marks) 3. Frequency Modulation (FM): In this question, you are asked to study the following FM signal, i.e., where fc = 5 × 105 Hz and fm = 104 Hz. The value of β that you should use depends on the last digit of your student ID; see the table below. Last digit 0 1 2 3 4 5 6 7 8 9 β 2 2.2 2.4 2.6 2.8 3 3.2 3.4 3.6 3.8 You need to generate a digital version of XFM (t) with a sampling frequency of 107 Hz. Create a .m script. named as“Q3_abcdefg.m”for answering the following sub-questions, where abcdefg is your student ID: a. Select the β value according to the above table. Then, based on the β value, obtain the theoretical frequency spectrum expression for XFM (t), assuming that XFM (t) lasts forever. You should use the MATLAB function “besselj” to evaluate the numerical value of the relevant Bessel functions of the first kind. (3 marks) b. In MATLAB, create and plot the signal XFM (t) for 3 × 10 4 second, where you must use the settings as mentioned previously. (2 marks) c. In MATLAB, plot the frequency spectrum of the signal in Q3-b using the MATLAB function “fft”, where the frequency spectrum plot must satisfy the requirements in Q1-d. (4 marks) d. Verify that the results in Q3-a and Q3-c agree with each other. (2 marks) e. In MATLAB, apply differentiation to the signal in Q3-b and plot the resultant signal XFM I(t). You may use the MATLAB function “gradient” for differentiation. Verify that the envelope of the signal XFM I(t) is oscillating at a frequency of fm Hz. (3 marks) f. In MATLAB, apply a hard limiter to the signal in Q3-b, where the amplitude of the hard limiter output is limited to the range of [—0.1, 0.1]. Then, plot the output signal of the hard limiter. (3 marks) g. Obtain the frequency spectrum of the output signal of the above hard limiter using the MATLAB function “fft”, where the spectrum must satisfy the requirements as specified in Q1-d. Then, compare this spectrum with the spectrum obtained from Q3-c and discuss any differences. (6 marks) h. Based on the result in Q3-g, apply a suitable bandpass filter to the output signal of the hard limiter such that the bandpass-filtered signal resembles XFM (t). Verify your result by examining the frequency spectrum of the bandpass-filtered signal. (4 marks) (Question 3 carries 27 marks)
MCD6020: Media and Culture Assessment 4: Video Essay Status: Individual Weighting: 25% Word limit: 3-minute video (keep to time limit, academic effort equivalent to a 1,000-word essay) Due date: Week 9 Assessment aims: 1. Develops the ability to explain how media makes culture through specific examples. 2. Develops creativity and the ability to incorporate visual imagery as a way of enhancing, illustrating, and exemplifying your discussion. Task Overview: You will create a video essay to explain how a media event, a media ritual, celebrity, or an act of media resistance makes or produces culture. You will use the media example you chose in A3 Annotated Bibliography. You will narrate the video yourself and use photos, clips, screen shots, memes, videos, or video extracts to create the imagery. Detailed Instructions: Use a video making platform. such as Canva to produce your video: https://www.canva.com/ 1. Define media and culture and the relationship between the two by explaining how media makes culture through ONE of the examples above (media event, ritual, celebrity, or resistance). 2. Use references from all of the following sources to support your explanation a. 2-4 specific media texts as examples (e.g. film, TV, games, social media, books, artworks, YouTube). b. FOUR readings from the relevant bibliography (chosen for your A3 Annotated Bibliography) c. TWO readings from library research related to your specific media examples. 3. Submit a word document with your details, the name of the assessment, your tutor’s name, a working link to your video (late penalties may apply if there is a delay in providing this) and a reference list (do not include the reference list in your video) Be creative in your use of images, editing, sound and your voiceover (NO RECORDED POWERPOINT PRESENTATIONS). Assessment Criteria: See rubric below Research: This will be conducted by consulting the bibliographies provided in Moodle and library research to show the ability to conduct independent research (cite sources by saying “According to Di Risio...” or “Di Risio argues/points out...”).
2024/25 ASSIGNMENT REMIT – DOCUMENT UPLOAD Programme Title FdA Business Enterprise BA (Hons) Business Enterprise FdA Business Management BA (Hons) Business Management Module Title Developing Collaborative Relationships Module Code 2099 ASSIGNMENT TITLE CW1 Portfolio Level 5 Weighting 70 % W/C Hand Out Date 17/02/2025 Due Date By 17:00 on 08/05/2025 Cut-off Date for Late Submissions (10 working days after the due date) By 17:00 on 22/05/2025 Feedback Post Date 09/06/2025 ASSIGNMENT FORMAT FILE UPLOAD (DOCUMENT) Essay/Report Format Other (please state in "Assignment Task" below) Assignment Word Count 1500 words Submission Format e-Submission Individual ASSIGNMENT TASK: You have been tasked with facilitating a successful collaborative relationship between organisations. You will work in a small group throughout the module to address a real-world business challenge and reflect on your individual development of interpersonal skills and collaborative behaviours throughout. MARKING CRITERIA: ● Below are the marking criteria that align with both the task(s) set and the quality of your document. Clear weightings/marks will be noted for each criterion. ● The overall mark awarded for this assignment will explicitly show how the mark was calculated based on your performance against each criterion. Reflective review Depth of reflection Analysis of experiences and application of theory Reflection on personal and interpersonal development Clarity and use of reflective model 50 marks Skills audit Identification and explanation of collaborative behaviours Analysis of experiences and application of theory Impact on employability and lifelong learning Clarity and use of template 40 marks Information gathering and references Quality, range and currency of references (10-15), which are embedded and acknowledged throughout. Adherence of reference list and in-text citations to the UCB referencing standards. 10 marks TASK AND DOCUMENT FORMAT GUIDANCE: Reflective review (Approx. 900 words) Using the Driscoll reflection model (what, so what, now what) identify and reflect on the interpersonal skills and collaborative behaviours that you have demonstrated and developed during your participation in a real-world business challenge. Describe your experience of working collaboratively during the real-world business challenge (What? Approx. 200 words) Analyse your experience of working collaboratively during the real-world business challenge using evidence from referenced sources (So what? Approx. 300 words) Reflect on how your experiences of working collaboratively during the real-world business challenge have impacted your development of interpersonal skills and overall personal development (Now what? Approx. 300 words) Skills Audit (approx. 700 words equivalent) · Identify 4-5 interpersonal skills that you think are important for developing effective collaborative relationships. · Provide a brief outline indicating how each skill is important for developing effective collaborative relationships with examples from the real-world business challenge and other contexts. Use evidence from referenced sources. · Rate your confidence in each skill from 1 to 5 before starting and after completing the real-world business challenge. · Discuss how your experiences and development in these skills will impact your employability and lifetime learning This should be written in the first person and you should use the template provided. E-SUBMISSION GUIDANCE: ● This assignment will require you to submit your work by uploading a document in Word or PDF format to Canvas. Please follow this online guide on document submissions and contact the DICE team on [email protected] if you need any further support. LEARNING OUTCOMES: ● Learning Outcomes are what the student needs to demonstrate after completing a module. An assessment is a way in which students can demonstrate their achievement of these Learning Outcomes. Learning Outcomes are NOT the same as the assignment task. 1. Assess how to develop personal effectiveness for successful collaborative relationships 2. Demonstrate the knowledge, self-awareness, soft skills, and behavioural attributes relevant to developing effective relationships, maximising employability, and lifetime learning ACADEMIC SKILLS OUTCOMES: ● The Academic Skills Outcomes to be developed by completing this assignment can be found here. ● For Apprenticeship programmes, identify the applicable Knowledge, Skills and Behaviours the assignment seeks to test.
CSCI-570 Spring 2025 Analysis of Algorithms Final Project Due: May 12, 2025 1 Guidelines You can work on this project in groups of no more than 3 people. 2 Project Description Implement the basic Dynamic Programming solution to the Sequence Alignment problem. Run the test set provided and show your results. 2.1 Algorithm Description Suppose we are given two strings X and Y , where X consists of the sequence of symbols x1 , x2 , . . . , xm and Y consists of the sequence of symbols y1 , y2 , . . . , yn. Consider the sets {1, 2,..., m} and {1, 2,..., n} as representing the different positions in the strings X and Y , and consider a matching of these sets; Recall that a matching is a set of ordered pairs with the property that each item occurs in at most one pair. We say that a matching M of these two sets is an alignment if there are no ”crossing” pairs: if (i, j), (i′ , j′ ) ∈ M and i < i′ , then j < j′ . Intuitively, an alignment gives a way of lining up the two strings, by telling us which pairs of positions will be lined up with one another. Our definition of similarity will be based on finding the optimal alignment between X and Y , according to the following criteria. Suppose M is a given alignment between X and Y: 1. First, there is a parameter δe > 0 that defines a gap penalty. For each position of X or Y that is not matched in M — it is a gap — we incur a cost of δ . 2. Second, for each pair of letters p, q in our alphabet, there is a mismatch cost of αpq for lining up p with q. Thus, for each (i,j) ∈ M, we pay the appropriate mismatch cost αxi yj for lining up xi with yj . One generally assumes that αpp = 0 for each letter p — there is no mismatch cost to line up a letter with another copy of itself — although this will not be necessary in anything that follows. 3. The cost of M is the sum of its gap and mismatch costs, and we seek an alignment of minimum cost. 2.2 Input string Generator The input to the program would be a text file containing the following information: 1. First base string (s1 ) 2. Next j lines consist of indices after which the copy of the previous string needs to be inserted in the cumulative string. (eg given below) 3. Second base string (s2 ) 4. Next k lines consist of indices after which the copy of the previous string needs to be inserted in the cumulative string. (eg given below) This information would help generate 2 strings from the original 2 base strings. This file could be used as an input to your program, and your program could use the base strings and the rules to generate the actual strings. Also note that the numbers j and k correspond to the first and the second string, respectively. Make sure you validate the length of the first and the second string to be 2j * len(s1 ) and 2k * len(s2 ). Please note that the base strings need not be of equal length and similarly, j need not be equal to k. Example: ACTG 3 6 1 TACG 1 2 9 Using the above numbers, the generated strings would be ACACTGACTACTGACTGGTGACTACTGACTGG and TATTATACGCTATTATACGCGACGCGGACGCG. Following is the step by step process on how the above strings are generated: ACTG ACTGACTG ACTGACTACTGACTGG ACACTGACTACTGACTGGTGACTACTGACTGG TACG TATACGCG TATTATACGCGACGCG TATTATACGCTATTATACGCGACGCGGACGCG 2.3 Values for Delta and Alphas Values for α’s are as follows. δe is equal to 30. 2.4 Programming/Scripting Languages Following are the list of languages which could be used: 1. C 2. C++ 3. Java 4. Python 5. Python3 2.5 Bounds 1. Basic Algorithm • 0 ≤ j, k ≤ 10 • 1 ≤ len(s1 ), len(s2 ) ≤ 2000 • 1 ≤ 2j * len(s1 ), 2k * len(s2 ) ≤ 2000 2. Memory Efficient Algorithm • 0 ≤ j, k ≤ 20 • 1 ≤ len(s1 ), len(s2 ) ≤ 20000 • 1 ≤ 2j * len(s1 ), 2k * len(s2 ) ≤ 20000 3 Goals Following are the goals to achieve for your project: 3.1 Your program should take 2 arguments: 1. Input file path 2. Output file path (If path is valid and file not found, your program should create it) Examples: python2 basic_2.py input .txt output .txt java Basic input .txt output .txt python3 basic_3.py input .txt output .txt Note: As mentioned in Part II-B input file will have data to generate strings. Since Gap penalty (δe ) and Mismatch penalty (αpq ) are FIXED, you have to hardcode them in your program. You are not allowed to use any libraries. 3.2 Implement the Dynamic Programming algorithm. Your program should print the following information at the respective lines in the output file: 1. Cost of the alignment (Integer) 2. First string alignment ( Consists of A, C, T, G, (gap) characters) 3. Second string alignment ( Consists of A, C, T, G, (gap) characters ) 4. Time in Milliseconds (Float) 5. Memory in Kilobytes (Float) Note: There can be multiple alignments that have the same cost. You can print ANY alignment generated by your program. The only condition is it should have a minimum cost. e.g. For strings s1 : A and s2 : C, alignments A , C and A, C both have alignment cost 60 which is minimum. You can print any one of them. 3.3 Implement the memory-efficient version of this solution and repeat the tests in Part B. 3.4 Plot the results of Part B and Part C using a line graph. Please use the provided input files in the ‘datapoints’ folder for generating the data points to plot the graph. 1. Single plot of CPU time vs problem size for the two solutions. 2. Single plot of Memory usage vs problem size for the two solutions. Units: CPU time - milliseconds, Memory in KB, problem size m+n 4 Submission 4.1 You should submit the ZIP file containing the following files: a. Basic algorithm file Name of the program file should be ‘basic.c’ / ‘basic.cpp’ / ‘Basic.java’ / ‘basic 2.py’ (Python 2.7) / ‘basic 3.py’ (Python 3) b. Memory efficient algorithm file Name of the program file should be ‘efficient.c’ / ‘efficient.cpp’ / ‘Efficient.java’ / ‘efficient 2.py’(Python 2.7) / ‘efficient 3.py’ (Python 3) c. Summary.pdf It must contain the following details: 1. Datapoints output table (which are generated from provided input files) 2. Two graphs and Insights 3. Contribution from each group member e.g. coding, testing, report preparation, etc. if every- body did not have equal contribution (Please use the provided Summary.docx file, fill in the details and upload it as PDF) d. 2 Shell files ‘basic.sh’ and ‘efficient.sh’ with the commands to compile and run your basic and efficient version. These are needed to provide you with flexibility in passing any additional compil- er/run arguments that your programs might need. See More Hints (VII part E for more details) Example: basic .sh javac Basic.java java Basic "$1" "$2" Execution: ./basic .sh input .txt output .txt ./efficient .sh input .txt output .txt 4.2 The name of your zip file should have the USC IDs (not email ids) of everyone in your group separated by an underscore. e.g. • 1234567890 1234567890 1234567890.zip • Contents (example): 1234567890_1234567890_1234567890 - basic_2.py - efficient_2.py - Summary.pdf - basic .sh - efficient .sh 5 Grading Please read the following instructions to understand how your submission will be evaluated. 5.1 Correctness of algorithms - 70 points 1. Both programs (basic/ efficient) are correctly outputting files having all 5 lines in the correct order: 15 points 2. Basic Algorithm: 25 points 3. Memory Efficient Algorithm: 30 points Note: Graders will execute your program on the ‘Linux‘ OS. The goal of Part A is to check correctness. The program should output a valid alignment having a minimum cost. Memory and Time will be evaluated in Part B. 5.2 Plots, analysis of results, insights and observations: 30 points 1. Your program will be run on the input files (provided by us in the ‘data points’ folder) to generate output files. The memory and time in the output files should be in a “close range” to what is given by you in the Summary.pdf. 2. Correctness of the graph 3. Correctness of Analysis/ Insights Note: Unlike Part A, the evaluation of Part B is subjective so it will be done manually. So it is alright if your graphs/data points have ‘some’ outliers. 6 What is provided to you in the zip file? A. SampleTestCases folder containing sample input and output files B. Datapoint folder containing input files to generate graph data points. C. Summary.docx file for reference 7 HINTS, NOTES, and FAQs 7.1 Regarding Input and string generation 1. We will never give an invalid input to your program. Input strings will always contain A, C, G, T only. 2. The length of the final input string should be equal to 2number of lines *len(base string), as mentioned in the document. 3. The string generation mechanism is the same irrespective of the basic or the efficient version of the algorithm. 4. The entire program (string generation, solution, write output) should be written in a single file. You may break those functions into different classes to make the code modular, but there should be only one file. Your program won’t be evaluated based on how modular it is. 7.2 Regarding Algorithm and output 1. DO NOT REFER TO THE PSEUDOCODE PROVIDED IN KLEINBERG AND TARDOS. 2. DO NOT USE ANY LIBRARIES FOR WRITING YOUR ALGORITHMS. 3. Samples for time and memory calculation are provided. Please use them for consistency. 4. Your solutions for the regular and memory-efficient algorithms should be in two different programs. 5. There can be multiple valid sequences with the same optimal cost; you can output any of those. All of them are valid. 6. You should code both the basic version and memory-efficient algorithm. Even though the memory- efficient version will pass all the bounds of the simple version, you must not use the memory-efficient version in both sub-problems. 7. Your program should not print anything when it runs. It should only write to the output file. 8. There is no specific requirement for the precision of Time and Memory float values. 9. Time and Memory depend on so many factors such as CPU, Operating System, etc. So there might be differences in the output. Therefore, it will be evaluated subjectively. There must be a clear distinction in behavior between programs whose Time/ Memory complexity is O(n) vs O(n2 ) vs O(log n). 7.3 Regarding the plot 1. Both the graphs are line graphs. The X-axis represents problem size as m+n, where m and n are the lengths of the generated string, and the Y-axis of the Memory plot represents memory in KB, and the Y-axis of the Time Plot represents time in milliseconds. The 2 lines in the graph will represent stats of basic and memory-efficient algorithms. 2. You can use any libraries/packages in any language to plot the graphs. 3. You do not have to provide code for generating the plots. Only add images in the Summary.pdf. 7.4 Regarding Submission 1. Only 1 person in the group needs to submit the project. We’ll get the USC IDs of all the other team members from the filenames. 2. To allow for grading the whole class in a reasonable amount of time, we’ll kill your program if it runs for more than a minute on a single input file.
Design Lab 2: Design of a switched-mode power supply Objective In this lab, we will design a step-down DC-DC voltage converter based on the Buck topology, as shown in Fig. 1, for a switched-mode power supply. We will first build a simulation model in Matlab Simulink to simulate the performance of the converter, and finalise the component values. After the simulation, we will implement the design with discrete components on a strip board, and measure its performance using lab instruments. The design specifications to achieve are as follows: Input voltage Vs = 24 V Minimum switching frequency Fmin = 50 kHz Output voltage Vout = 5 V Output current Io = 50 mA Output ripple voltage Vripple p-p = 25 mV Simulink settings: Simulation time = 0.01 s. Use ideal switches and disable Snubbers, On resistance and forward voltage drop in switching devices. Try both the Continuous and Discrete solver options. What difference do you see? In the Discrete option, consider what sample time is appropriate. Fig. 1 Simulink model of the Buck converter Task 1 Plot the simulated inductor current (IL) and output voltage (Vout) waveforms. Compare the results with theoretical waveforms shown in page 3 of your SMPS lecture notes. Fig. 2 Simulated current of the inductor L and output voltage Task 2 Now replace the passive LC components with realistic models to represent their physical performance. Discuss what impact the parasitic of the LC components have on the waveforms of the Buck converter. Fig. 3 Parasitic resistances added to the inductor and capacitor of the DC-DC Buck converter Task 3 Use MOSFET and diode model parameters provided by any suitable manufacturer of your choice. Insert these into the Buck converter model. Disable the use ideal switching devices in the Solver option. Simulate and compare the simulated waveforms with the ideal model case. Fig. 4 MOSFET and Diode model included for the DC-DC Buck converter Task 4 Modify the duty cycle of the pulse width modulated signal for the pulse generator and/or adjust the passive L C components to achieve the original design specifications of the Buck converter. Determine the efficiency of your Buck switched-mode power supply final design. Task 5 Implement your finalised design with passive LC components, an n-channel MOSFET and a Schottky diode on a strip board. Use the power supply unit in the lab to provide the 24 V supply voltage, and the signal generator as the pulse generator. Use an oscilloscope to measure the voltage across RL. Determine the efficiency of your final design. How does it compare to your simulation results, and why? Please refer to the datasheets of your chosen components for your analysis. There is a list of available components in the appendix of this document. Each component has an order code from either Farnell or RS. You can find the datasheet by searching the order code on Farnell or RS websites: https://uk.farnell.com/ https://uk.rs-online.com/web/ Reports . There are two reports and a strip board implementation required for all students: - Report 1 on Task 1 – 4; - Report 2 on Task 5. - Strip board implemented in Task 5. . Each report should be no more than three pages . Submit your reports to Moodle. . In Report 1: - write a brief introduction (not more than 500 words) about the simulations and Matlab Simulink - Show clearly your Simulink model schematics, parameters used and your simulated results in high quality figures . In Report 2: - Clearly list the parameters and the part numbers of the components you use for the circuit implementation. Refer to your Simulink schematic of each component . In Both reports, there should be a discussion section. For Report 1, answer the questions in Tasks 2, 3, and 4. For Report 2, discuss the impact from the real component parameters on the output, and your adjustment to compensate. . Please clearly label your name on the stripboard. Appendix: Component List Note: Components may be from different suppliers. Check on their website using the order code in the table to find the appropriate datasheets. Item Farnell Order code IRLB8748PBF – Power MOSFET, N Channel 3155154 Inductor, Coilcraft, 680 uH 2526926 / 2211735 Inductor, Panasonic, 820 uH 2211717 Inductor, Coilcraft, 1000 uH 3291051 Capacitor, tantalum, 16V, 4.7uF 9708324 Capacitor, tantalum, 16V, 6.8uF 9708332 Capacitor, tantalum, 16V, 10uF 9708340 Capacitor, tantalum, 16V, 22uF 9708359 Capacitor, tantalum, 16V, 33uF 1100471 Diode, IN4003 2723902